Free Access

Figure 2.

thumbnail

Télécharger l'image originale

Contrôle différentiel des promoteurs de TAp73 et ΔNp73. A. Le promoteur P1 contrôle la transcription de TAp73, l’isoforme la plus longue, et le promoteur P2 celle de l’isoforme ΔNp73, qui débute à partir de l’exon 3bis. Les sites de fixation de E2F1 (E2F transcription factor 1) sont présents dans P1 et P2, alors que les sites de fixation de p53 sont présents seulement dans P2. La séquence cible consensus de p53 est RRRCWWGYYYRRRCWWGYYY, alors que la séquence cible de p73 dans P2 est GGGCAAGCTGAGGCCTGCCC [6] (R : purine ; Y : pyrimidine, W : adénine ou thymidine). B. Modèle de régulation transcriptionnelle de TAp73 et ΔNp73. La surexpression de p53 ou de TAp73 induit l’expression de son antagoniste ΔNp73. Cette isoforme va inhiber la fonction apoptotique de p53 ou de TAp73. L’association de l’isoforme ΔNp73 avec les protéines p53 ou TAp73 réprime la transcription des gènes cibles.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.